You can not select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.
 
 
 
 
 
 

44 lines
1.2 KiB

if !System.get_env("EXERCISM_TEST_EXAMPLES") do
Code.load_file("nucleotide_count.exs", __DIR__)
end
ExUnit.start()
ExUnit.configure(exclude: :pending, trace: true)
defmodule NucleotideCountTest do
use ExUnit.Case
# @tag :pending
test "empty dna string has no adenine" do
assert NucleotideCount.count('', ?A) == 0
end
# @tag :pending
test "repetitive cytosine gets counted" do
assert NucleotideCount.count('CCCCC', ?C) == 5
end
# @tag :pending
test "counts only thymine" do
assert NucleotideCount.count('GGGGGTAACCCGG', ?T) == 1
end
# @tag :pending
test "empty dna string has no nucleotides" do
expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 0}
assert NucleotideCount.histogram('') == expected
end
# @tag :pending
test "repetitive sequence has only guanine" do
expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 8}
assert NucleotideCount.histogram('GGGGGGGG') == expected
end
# @tag :pending
test "counts all nucleotides" do
s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
expected = %{?A => 20, ?T => 21, ?C => 12, ?G => 17}
assert NucleotideCount.histogram(s) == expected
end
end